Sequence retrieval

Genome: Paenibacillus polymyxa E681
Start position: 1447704
End position: 1447733
Length: 30

DNA sequence
>NC_014483, from 1447704 to 1447733 (30 bp); Paenibacillus polymyxa E681 AAAAATAAGCAAACATAAGGATAAAAAAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1446724-1447995	Sequence	PPE_01348 - Permease of the major facilitator superfamily (Protein is coded in complementary strand; from 1447995 to 1446724)