Sequence retrieval

Genome: Paenibacillus polymyxa E681
Start position: 1686015
End position: 1686038
Length: 24

DNA sequence
>NC_014483, from 1686015 to 1686038 (24 bp); Paenibacillus polymyxa E681 TGCAGGTGCAAGTGCAGATGCAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1685644-1686558	Sequence	PPE_01577 - transcriptional regulator (Protein is coded in complementary strand; from 1686558 to 1685644)