Sequence retrieval

Genome: Paenibacillus polymyxa E681
Start position: 2797448
End position: 2797471
Length: 24

DNA sequence
>NC_014483, from 2797448 to 2797471 (24 bp); Paenibacillus polymyxa E681 GTGCTGTAGTGCTGTAGTGCTGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2796960-2797457	Sequence	PPE_02536 - cell wall-associated hydrolase (invasion-associated protein)