Sequence retrieval

Genome: Paenibacillus polymyxa E681
Start position: 2802659
End position: 2802688
Length: 30

DNA sequence
>NC_014483, from 2802659 to 2802688 (30 bp); Paenibacillus polymyxa E681 ATTTAGTTGATTTTAGTTAACTTTACTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2802672-2804252	Sequence	PPE_02544 - ABC transporter ATPase (Protein is coded in complementary strand; from 2804252 to 2802672)