Sequence retrieval

Genome: Paenibacillus polymyxa E681
Start position: 3029563
End position: 3029589
Length: 27

DNA sequence
>NC_014483, from 3029563 to 3029589 (27 bp); Paenibacillus polymyxa E681 CACGAGGTGCACGAGATGCACGTGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3029469-3030695	Sequence	PPE_02770 - 30S ribosomal protein S1 (Protein is coded in complementary strand; from 3030695 to 3029469)