Sequence retrieval

Genome: Paenibacillus polymyxa E681
Start position: 3271621
End position: 3271647
Length: 27

DNA sequence
>NC_014483, from 3271621 to 3271647 (27 bp); Paenibacillus polymyxa E681 TCATACGTTTCATACGTTTCATTCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3269757-3271643	Sequence	PPE_02999 - hypothetical protein (Protein is coded in complementary strand; from 3271643 to 3269757)