Sequence retrieval

Genome: Paenibacillus polymyxa E681
Start position: 4770878
End position: 4770913
Length: 36

DNA sequence
>NC_014483, from 4770878 to 4770913 (36 bp); Paenibacillus polymyxa E681 TCTGTAGTGCTATCTGTAGTGCTATCTGTAGTCGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4770599-4771726	Sequence	PPE_04370 - hypothetical protein (Protein is coded in complementary strand; from 4771726 to 4770599)