Sequence retrieval

Genome: Paenibacillus polymyxa E681
Start position: 4900230
End position: 4900254
Length: 25

DNA sequence
>NC_014483, from 4900230 to 4900254 (25 bp); Paenibacillus polymyxa E681 TCATATCAGATCATCCCATATCTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 4898987-4900234	Sequence	PPE_04472 - hypothetical protein (Protein is coded in complementary strand; from 4900234 to 4898987)