Sequence retrieval

Genome: Paenibacillus polymyxa E681
Start position: 4971790
End position: 4971813
Length: 24

DNA sequence
>NC_014483, from 4971790 to 4971813 (24 bp); Paenibacillus polymyxa E681 GTGATCATGATCGTGATGGTGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4971530-4972726	Sequence	PPE_04547 - Sirohydrochlorin cobaltochelatase (CbiXL) (Protein is coded in complementary strand; from 4972726 to 4971530)