Sequence retrieval

Genome: Paenibacillus polymyxa E681
Start position: 668308
End position: 668334
Length: 27

DNA sequence
>NC_014483, from 668308 to 668334 (27 bp); Paenibacillus polymyxa E681 CTCCCGTAACTCCTGTAACGCCCGTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 667779-669071	Sequence	PPE_00612 - hypothetical protein (Protein is coded in complementary strand; from 669071 to 667779)