Sequence retrieval

Genome: Sulfurimonas autotrophica DSM 16294
Start position: 1403258
End position: 1403281
Length: 24

DNA sequence
>NC_014506, from 1403258 to 1403281 (24 bp); Sulfurimonas autotrophica DSM 16294 AAAAAATAAAAAAAAGAATAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1402630-1403298	Sequence	Saut_1422 - hypothetical protein (Protein is coded in complementary strand; from 1403298 to 1402630)