Sequence retrieval

Genome: Sulfurimonas autotrophica DSM 16294
Start position: 1729565
End position: 1729589
Length: 25

DNA sequence
>NC_014506, from 1729565 to 1729589 (25 bp); Sulfurimonas autotrophica DSM 16294 AAAAAAAATAGAAAAAAAAGTAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1728680-1729600	Sequence	Saut_1744 - hypothetical protein (Protein is coded in complementary strand; from 1729600 to 1728680)