Sequence retrieval

Genome: Sulfurimonas autotrophica DSM 16294
Start position: 1785169
End position: 1785192
Length: 24

DNA sequence
>NC_014506, from 1785169 to 1785192 (24 bp); Sulfurimonas autotrophica DSM 16294 CCAAATCCAAATCAAAATTCAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1784172-1786589	Sequence	Saut_1796 - ATP-dependent proteinase (Protein is coded in complementary strand; from 1786589 to 1784172)