Sequence retrieval

Genome: Sulfurimonas autotrophica DSM 16294
Start position: 1852840
End position: 1852902
Length: 63

DNA sequence
>NC_014506, from 1852840 to 1852902 (63 bp); Sulfurimonas autotrophica DSM 16294 CCTCTTGTTTTGCACGCTGTACTTCTTGTTCTGCGCGTTGTACTTCTTGTTTTGCAAGTTGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1852548-1853633	Sequence	Saut_1861 - hypothetical protein (Protein is coded in complementary strand; from 1853633 to 1852548)