Sequence retrieval

Genome: Sulfurimonas autotrophica DSM 16294
Start position: 1867175
End position: 1867210
Length: 36

DNA sequence
>NC_014506, from 1867175 to 1867210 (36 bp); Sulfurimonas autotrophica DSM 16294 ACTTTTTTAACTACTTTTTTAACTACTTTTTTAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1867133-1867393	Sequence	Saut_1874 - histone H1 (Protein is coded in complementary strand; from 1867393 to 1867133)