Sequence retrieval

Genome: Sulfurimonas autotrophica DSM 16294
Start position: 359965
End position: 359988
Length: 24

DNA sequence
>NC_014506, from 359965 to 359988 (24 bp); Sulfurimonas autotrophica DSM 16294 TATATAAATCTATAAATATATCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 359313-360203	Sequence	Saut_0382 - tRNA delta(2)-isopentenylpyrophosphate transferase (Protein is coded in complementary strand; from 360203 to 359313)