Sequence retrieval

Genome: Sulfurimonas autotrophica DSM 16294
Start position: 378253
End position: 378276
Length: 24

DNA sequence
>NC_014506, from 378253 to 378276 (24 bp); Sulfurimonas autotrophica DSM 16294 CTTCATCCTCATCTTCTTCTTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 376875-378446	Sequence	Saut_0398 - hypothetical protein (Protein is coded in complementary strand; from 378446 to 376875)