Sequence retrieval

Genome: Sulfurimonas autotrophica DSM 16294
Start position: 425027
End position: 425080
Length: 54

DNA sequence
>NC_014506, from 425027 to 425080 (54 bp); Sulfurimonas autotrophica DSM 16294 TTTTTTTTCATGACAACATCTTTTTTTATAACAACATCTTTTTTAATGACAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 424316-425245	Sequence	Saut_0447 - hypothetical protein (Protein is coded in complementary strand; from 425245 to 424316)