Sequence retrieval

Genome: Sulfurimonas autotrophica DSM 16294
Start position: 427058
End position: 427093
Length: 36

DNA sequence
>NC_014506, from 427058 to 427093 (36 bp); Sulfurimonas autotrophica DSM 16294 TATTATTGGTATTATTGGTATTATTGGTATTATTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 426031-427545	Sequence	Saut_0449 - type II and III secretion system protein (Protein is coded in complementary strand; from 427545 to 426031)