Sequence retrieval

Genome: Sulfurimonas autotrophica DSM 16294
Start position: 622554
End position: 622583
Length: 30

DNA sequence
>NC_014506, from 622554 to 622583 (30 bp); Sulfurimonas autotrophica DSM 16294 GAAAAACTGACAAAAACAGAGAAAAATTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 619878-622688	Sequence	Saut_0641 - PAS/PAC sensor-containing diguanylate cyclase/phosphodiesterase (Protein is coded in complementary strand; from 622688 to 619878)