Sequence retrieval

Genome: Sulfurimonas autotrophica DSM 16294
Start position: 89529
End position: 89561
Length: 33

DNA sequence
>NC_014506, from 89529 to 89561 (33 bp); Sulfurimonas autotrophica DSM 16294 GATTATTTAGGGATTATTTATGGATTATTTATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 89560-91254	Sequence	Saut_0084 - response regulator receiver modulated diguanylate cyclase/phosphodiesterase