Sequence retrieval

Genome: Sulfurimonas autotrophica DSM 16294
Start position: 918011
End position: 918034
Length: 24

DNA sequence
>NC_014506, from 918011 to 918034 (24 bp); Sulfurimonas autotrophica DSM 16294 TTTGTTTTTCTTTTTGTATATGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 917894-918847	Sequence	Saut_0937 - periplasmic nitrate reductase component NapL (Protein is coded in complementary strand; from 918847 to 917894)