Sequence retrieval

Genome: Lactobacillus plantarum subsp. plantarum ST-III
Start position: 1364442
End position: 1364465
Length: 24

DNA sequence
>NC_014554, from 1364442 to 1364465 (24 bp); Lactobacillus plantarum subsp. plantarum ST-III GTGATAGCGATAATGATATTGATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1364044-1364766	Sequence	LPST_C1235 - integral membrane protein (Protein is coded in complementary strand; from 1364766 to 1364044)