Sequence retrieval

Genome: Lactobacillus plantarum subsp. plantarum ST-III
Start position: 1396657
End position: 1396680
Length: 24

DNA sequence
>NC_014554, from 1396657 to 1396680 (24 bp); Lactobacillus plantarum subsp. plantarum ST-III GATGAAGACGAAGATGAAGCTGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1395542-1396738	Sequence	LPST_C1272 opuA ABC superfamily ATP binding cassette transporter, ABC protein