Sequence retrieval

Genome: Lactobacillus plantarum subsp. plantarum ST-III
Start position: 2012086
End position: 2012109
Length: 24

DNA sequence
>NC_014554, from 2012086 to 2012109 (24 bp); Lactobacillus plantarum subsp. plantarum ST-III ATCTTCATCATCACCTTCATCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2011937-2012449	Sequence	LPST_C1872 - hypothetical protein (Protein is coded in complementary strand; from 2012449 to 2011937)