Sequence retrieval

Genome: Lactobacillus plantarum subsp. plantarum ST-III
Start position: 2031102
End position: 2031125
Length: 24

DNA sequence
>NC_014554, from 2031102 to 2031125 (24 bp); Lactobacillus plantarum subsp. plantarum ST-III TTGTTGATGTTGTTGTTGTTGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2030821-2031204	Sequence	LPST_C1892 - translocase subunit (Protein is coded in complementary strand; from 2031204 to 2030821)