Sequence retrieval

Genome: Lactobacillus plantarum subsp. plantarum ST-III
Start position: 3170690
End position: 3170713
Length: 24

DNA sequence
>NC_014554, from 3170690 to 3170713 (24 bp); Lactobacillus plantarum subsp. plantarum ST-III ATTACTAATACTATTACTAGTACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3169299-3171110	Sequence	LPST_C2945 - hypothetical protein (Protein is coded in complementary strand; from 3171110 to 3169299)