Sequence retrieval

Genome: Lactobacillus plantarum subsp. plantarum ST-III
Start position: 534558
End position: 534581
Length: 24

DNA sequence
>NC_014554, from 534558 to 534581 (24 bp); Lactobacillus plantarum subsp. plantarum ST-III TGAACTTGAACTGGAACTTGAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 534427-535638	Sequence	LPST_C0496 - transcription regulator (Protein is coded in complementary strand; from 535638 to 534427)