Sequence retrieval

Genome: Lactobacillus plantarum subsp. plantarum ST-III
Start position: 789933
End position: 789956
Length: 24

DNA sequence
>NC_014554, from 789933 to 789956 (24 bp); Lactobacillus plantarum subsp. plantarum ST-III TTTCGATTTTGATTTTGAATTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 789915-791162	Sequence	LPST_C0723 - transposase (Protein is coded in complementary strand; from 791162 to 789915)