Sequence retrieval

Genome: Lactobacillus plantarum subsp. plantarum ST-III
Start position: 2263456
End position: 2263482
Length: 27

DNA sequence
>NC_014554, from 2263456 to 2263482 (27 bp); Lactobacillus plantarum subsp. plantarum ST-III CCTGGTTCACCTGGTTTACTTGGTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2262940-2264982	Sequence	LPST_C2123 - cell surface protein (Protein is coded in complementary strand; from 2264982 to 2262940)