Sequence retrieval

Genome: Lactobacillus plantarum subsp. plantarum ST-III
Start position: 2781058
End position: 2781087
Length: 30

DNA sequence
>NC_014554, from 2781058 to 2781087 (30 bp); Lactobacillus plantarum subsp. plantarum ST-III GACTCAGATTCAGAATCAGATTCAGACTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2780294-2781565	Sequence	LPST_C2586 - integral membrane protein ()