Sequence retrieval

Genome: Lactobacillus plantarum subsp. plantarum ST-III
Start position: 1829033
End position: 1829065
Length: 33

DNA sequence
>NC_014554, from 1829033 to 1829065 (33 bp); Lactobacillus plantarum subsp. plantarum ST-III GCGGTCCATTGTCCGTCCATTGGTTGTCCATTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1828642-1829439	Sequence	LPST_C1693 - hypothetical protein (Protein is coded in complementary strand; from 1829439 to 1828642)