Sequence retrieval

Genome: Lactobacillus plantarum subsp. plantarum ST-III
Start position: 2170102
End position: 2170134
Length: 33

DNA sequence
>NC_014554, from 2170102 to 2170134 (33 bp); Lactobacillus plantarum subsp. plantarum ST-III AAAGTTCGGTTAAAGTCCGGTTTGAGTTCGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2170112-2170573	Sequence	LPST_C2024 - prophage Lp1 protein 33 (Protein is coded in complementary strand; from 2170573 to 2170112)