Sequence retrieval

Genome: Lactobacillus plantarum subsp. plantarum ST-III
Start position: 2455876
End position: 2455911
Length: 36

DNA sequence
>NC_014554, from 2455876 to 2455911 (36 bp); Lactobacillus plantarum subsp. plantarum ST-III ATTTCAGGGGTTTCAGGGGTTTCAGGGGTTTCAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2455411-2458356	Sequence	LPST_C2298 - cell surface protein precursor (Protein is coded in complementary strand; from 2458356 to 2455411)