Sequence retrieval

Genome: Lactobacillus plantarum subsp. plantarum ST-III
Start position: 1828987
End position: 1829031
Length: 45

DNA sequence
>NC_014554, from 1828987 to 1829031 (45 bp); Lactobacillus plantarum subsp. plantarum ST-III ACCTTACCTTTACTAACCTTACCTAACCTAACCTTACCTAACCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1828642-1829439	Sequence	LPST_C1693 - hypothetical protein (Protein is coded in complementary strand; from 1829439 to 1828642)