Sequence retrieval

Genome: Lactobacillus plantarum subsp. plantarum ST-III
Start position: 2712780
End position: 2712827
Length: 48

DNA sequence
>NC_014554, from 2712780 to 2712827 (48 bp); Lactobacillus plantarum subsp. plantarum ST-III TGCCACTGCTATTGCCACTGCTATTGCCACTGCTATTGCCACTGCTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2710343-2713132	Sequence	LPST_C2531 - cell surface protein (Protein is coded in complementary strand; from 2713132 to 2710343)