Sequence retrieval

Genome: Lactobacillus plantarum subsp. plantarum ST-III
Start position: 1159266
End position: 1159319
Length: 54

DNA sequence
>NC_014554, from 1159266 to 1159319 (54 bp); Lactobacillus plantarum subsp. plantarum ST-III GACGGCGACAGTGATTCGGATAGCGACAGTGATTCGGACTCTGACAGTGATTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1155430-1163775	Sequence	LPST_C1056 sdr cell surface SD repeat-containing protein