Sequence retrieval

Genome: Lactobacillus plantarum subsp. plantarum ST-III
Start position: 3236770
End position: 3236823
Length: 54

DNA sequence
>NC_014554, from 3236770 to 3236823 (54 bp); Lactobacillus plantarum subsp. plantarum ST-III TTGCCTTATTTCCGTTTCTTGCCTTATTTCCGTTTCTTGCCTTTTTTCTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3236794-3237216	Sequence	LPST_C2999 - transcription regulator (Protein is coded in complementary strand; from 3237216 to 3236794)