Sequence retrieval

Genome: Lactobacillus plantarum subsp. plantarum ST-III
Start position: 181477
End position: 181548
Length: 72

DNA sequence
>NC_014554, from 181477 to 181548 (72 bp); Lactobacillus plantarum subsp. plantarum ST-III TCGAACCAAGTGAACCGAGCGAACCAAGCGAACCGAGTGAACCAAGTGAGCCGAGCGAACCGAGTGAACC AA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 179602-181968	Sequence	LPST_C0159 - cell surface protein precursor