Sequence retrieval

Genome: Bifidobacterium bifidum PRL2010
Start position: 1500918
End position: 1500941
Length: 24

DNA sequence
>NC_014638, from 1500918 to 1500941 (24 bp); Bifidobacterium bifidum PRL2010 CGGCCACGGCCACGCCCACCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1500410-1501372	Sequence	BBPR_1280 - drug/metabolite exporter family transporter (Protein is coded in complementary strand; from 1501372 to 1500410)