Sequence retrieval

Genome: Bifidobacterium bifidum PRL2010
Start position: 1818632
End position: 1818655
Length: 24

DNA sequence
>NC_014638, from 1818632 to 1818655 (24 bp); Bifidobacterium bifidum PRL2010 CGACGTCGAGGTCGGCGTCGAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1818196-1819107	Sequence	BBPR_1528 truA tRNA pseudouridine synthase A (Protein is coded in complementary strand; from 1819107 to 1818196)