Sequence retrieval

Genome: Bifidobacterium bifidum PRL2010
Start position: 1883617
End position: 1883640
Length: 24

DNA sequence
>NC_014638, from 1883617 to 1883640 (24 bp); Bifidobacterium bifidum PRL2010 TGGTGACGGTGATGATGATGTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1882572-1883966	Sequence	BBPR_1598 - guanine-hypoxanthine permease (Protein is coded in complementary strand; from 1883966 to 1882572)