Sequence retrieval

Genome: Bifidobacterium bifidum PRL2010
Start position: 58312
End position: 58335
Length: 24

DNA sequence
>NC_014638, from 58312 to 58335 (24 bp); Bifidobacterium bifidum PRL2010 TGGCGTTGGCGCGGGCGTTGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 58260-59357	Sequence	BBPR_0046 trpS TrpS Tryptophanyl-tRNA synthetase (Protein is coded in complementary strand; from 59357 to 58260)