Sequence retrieval

Genome: Bifidobacterium bifidum PRL2010
Start position: 426273
End position: 426299
Length: 27

DNA sequence
>NC_014638, from 426273 to 426299 (27 bp); Bifidobacterium bifidum PRL2010 GCCGAAGTGGCCGAACTGGCCGAAGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 425530-427422	Sequence	BBPR_0347 ilvB acetolactate synthase large subunit IlvB