Sequence retrieval

Genome: Bifidobacterium bifidum PRL2010
Start position: 988111
End position: 988137
Length: 27

DNA sequence
>NC_014638, from 988111 to 988137 (27 bp); Bifidobacterium bifidum PRL2010 GCATCGCCAGCATCGCCCCCATCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 986802-988787	Sequence	BBPR_0797 - acyltransferase (Protein is coded in complementary strand; from 988787 to 986802)