Sequence retrieval

Genome: Bifidobacterium bifidum PRL2010
Start position: 111570
End position: 111614
Length: 45

DNA sequence
>NC_014638, from 111570 to 111614 (45 bp); Bifidobacterium bifidum PRL2010 GTCTCGTTGGCGTCGGTCTCGTTGGTGTCCGTGTCCTTGACGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 111228-111683	Sequence	BBPR_0097 - hypothetical protein (Protein is coded in complementary strand; from 111683 to 111228)