Sequence retrieval

Genome: Bifidobacterium bifidum PRL2010
Start position: 1539169
End position: 1539213
Length: 45

DNA sequence
>NC_014638, from 1539169 to 1539213 (45 bp); Bifidobacterium bifidum PRL2010 CACAGAAGCGCTGTTAACAGGAGTGCTGTTAACAGGAGCGCTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1539119-1539811	Sequence	BBPR_1304 - hypothetical protein (Protein is coded in complementary strand; from 1539811 to 1539119)