Sequence retrieval

Genome: Bifidobacterium bifidum PRL2010
Start position: 2052651
End position: 2052710
Length: 60

DNA sequence
>NC_014638, from 2052651 to 2052710 (60 bp); Bifidobacterium bifidum PRL2010 CGGTCTTCTTCGCTGCGGTCTTCCTGGCCGTGGTCTTCTTGGCGGCCGTCTTTTTCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2052644-2055562	Sequence	BBPR_1738 topA DNA topoisomerase I (Protein is coded in complementary strand; from 2055562 to 2052644)