Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 1281349
End position: 1281372
Length: 24

DNA sequence
>NC_014659, from 1281349 to 1281372 (24 bp); Rhodomicrobium equis 103S GGCCGACGCCGATGCCGAGGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1280793-1281662	Sequence	REQ_12300 - hypothetical protein (Protein is coded in complementary strand; from 1281662 to 1280793)