Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 1552048
End position: 1552071
Length: 24

DNA sequence
>NC_014659, from 1552048 to 1552071 (24 bp); Rhodomicrobium equis 103S GCCGTCGCGGTCTCCGTCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1551040-1552380	Sequence	REQ_14940 - amidase (Protein is coded in complementary strand; from 1552380 to 1551040)